| dc.contributor.author | Yoon, Sohye | |
| dc.contributor.author | Mitra, Suman | |
| dc.contributor.author | Wyse, Cathy | |
| dc.contributor.author | Alnabulsi, Ayham | |
| dc.contributor.author | Zou, Jun | |
| dc.contributor.author | Weerdenburg, Eveline M. | |
| dc.contributor.author | van der Sar, Astrid | |
| dc.contributor.author | Wang, Difei | |
| dc.contributor.author | Secombes, Christopher J. | |
| dc.contributor.author | Bird, Steve | |
| dc.date.accessioned | 2015-07-23T10:13:04Z | |
| dc.date.available | 2015-07-23T10:13:04Z | |
| dc.date.issued | 2015-06-17 | |
| dc.identifier.citation | Yoon , S , Mitra , S , Wyse , C , Alnabulsi , A , Zou , J , Weerdenburg , E M , van der Sar , A , Wang , D , Secombes , C J & Bird , S 2015 , ' First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio) ' , PloS ONE , vol. 10 , no. 6 , 0126378 . https://doi.org/10.1371/journal.pone.0126378 | en |
| dc.identifier.issn | 1932-6203 | |
| dc.identifier.other | PURE: 49836965 | |
| dc.identifier.other | PURE UUID: 1d2659f5-5281-45d4-847b-446ecb43ec7b | |
| dc.identifier.other | Scopus: 84939204269 | |
| dc.identifier.uri | http://hdl.handle.net/2164/4695 | |
| dc.description | Acknowledgments Both first authors were supported by the Scottish Overseas Research Scholarship Awards Scheme (SORSAS) to undertake a PhD program at the University of Aberdeen. Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio) Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M. Weerdenburg, Astrid M. van der Sar, Difei Wang, Christopher J. Secombes, Steve Bird Published: December 21, 2016 http://dx.doi.org/10.1371/journal.pone.0169149 The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'. | en |
| dc.format.extent | 26 | |
| dc.language.iso | eng | |
| dc.relation.ispartof | PloS ONE | en |
| dc.rights | This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0/ | en |
| dc.subject | SDG 3 - Good Health and Well-being | en |
| dc.subject | QH301 Biology | en |
| dc.subject.lcc | QH301 | en |
| dc.title | First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio) | en |
| dc.type | Journal article | en |
| dc.contributor.institution | University of Aberdeen.Biological Sciences | en |
| dc.contributor.institution | University of Aberdeen.Scottish Fish Immunology Research Centre | en |
| dc.contributor.institution | University of Aberdeen.Marine Alliance for Science and Technology for Scotland (MASTS) | en |
| dc.description.status | Peer reviewed | en |
| dc.description.version | Publisher PDF | en |
| dc.identifier.doi | https://doi.org/10.1371/journal.pone.0126378 | |
