Show simple item record

dc.contributor.authorYoon, Sohye
dc.contributor.authorMitra, Suman
dc.contributor.authorWyse, Cathy
dc.contributor.authorAlnabulsi, Ayham
dc.contributor.authorZou, Jun
dc.contributor.authorWeerdenburg, Eveline M.
dc.contributor.authorvan der Sar, Astrid
dc.contributor.authorWang, Difei
dc.contributor.authorSecombes, Christopher J.
dc.contributor.authorBird, Steve
dc.date.accessioned2015-07-23T10:13:04Z
dc.date.available2015-07-23T10:13:04Z
dc.date.issued2015-06-17
dc.identifier.citationYoon , S , Mitra , S , Wyse , C , Alnabulsi , A , Zou , J , Weerdenburg , E M , van der Sar , A , Wang , D , Secombes , C J & Bird , S 2015 , ' First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio) ' , PloS ONE , vol. 10 , no. 6 , 0126378 . https://doi.org/10.1371/journal.pone.0126378en
dc.identifier.issn1932-6203
dc.identifier.otherPURE: 49836965
dc.identifier.otherPURE UUID: 1d2659f5-5281-45d4-847b-446ecb43ec7b
dc.identifier.otherScopus: 84939204269
dc.identifier.urihttp://hdl.handle.net/2164/4695
dc.descriptionAcknowledgments Both first authors were supported by the Scottish Overseas Research Scholarship Awards Scheme (SORSAS) to undertake a PhD program at the University of Aberdeen. Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio) Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M. Weerdenburg, Astrid M. van der Sar, Difei Wang, Christopher J. Secombes, Steve Bird Published: December 21, 2016 http://dx.doi.org/10.1371/journal.pone.0169149 The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'.en
dc.format.extent26
dc.language.isoeng
dc.relation.ispartofPloS ONEen
dc.rightsThis is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0/en
dc.subjectSDG 3 - Good Health and Well-beingen
dc.subjectQH301 Biologyen
dc.subject.lccQH301en
dc.titleFirst demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio)en
dc.typeJournal articleen
dc.contributor.institutionUniversity of Aberdeen.Biological Sciencesen
dc.contributor.institutionUniversity of Aberdeen.Scottish Fish Immunology Research Centreen
dc.contributor.institutionUniversity of Aberdeen.Marine Alliance for Science and Technology for Scotland (MASTS)en
dc.description.statusPeer revieweden
dc.description.versionPublisher PDFen
dc.identifier.doihttps://doi.org/10.1371/journal.pone.0126378


Files in this item

Thumbnail

This item appears in the following Collection(s)

Show simple item record